View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16023_high_13 (Length: 355)
Name: NF16023_high_13
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16023_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 8 - 339
Target Start/End: Original strand, 48257858 - 48258180
Alignment:
| Q |
8 |
tgagatgaaaaatgataagctataagttttaagcaacttgaacaactttcaattacacatgcctattcagattctgacaacatagcaaagtatttatgat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48257858 |
tgagatgaaaaatgataagctataagttttaagcaacttgaacaactttcaattaaacatgcttattcagattctgacaacatagcaaagtatttatgat |
48257957 |
T |
 |
| Q |
108 |
cacctacccatatatgtcattctaagaacatagttttcaatttcctcatggaaatgataagaagcaagttgagagggtgaaaggaaaaacatttatcctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48257958 |
cacctacccatatatgtcattctaagaacaaagttttca---------tggaaatgataagaagcaagttgagagggtgaaaggaaaaacatttatcctt |
48258048 |
T |
 |
| Q |
208 |
ctctagtatggctgttttaatcaggacaacgttccaagatattcctacctatgttataagttgctttttgattcctcgagggaatttgtgatagaattaa |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48258049 |
ctctagtatggctgttttaatcaggacaacgttccaagatattcctacctatgttataagttgctttttgattcctcgagggaatttgtgatagaattaa |
48258148 |
T |
 |
| Q |
308 |
acaatctatatgtaggttttggtggggaggaa |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48258149 |
acaatctatatgtaggttttggtggggaggaa |
48258180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University