View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16023_high_14 (Length: 352)
Name: NF16023_high_14
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16023_high_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 101 - 337
Target Start/End: Complemental strand, 42692839 - 42692600
Alignment:
| Q |
101 |
gatcgttcaaatatcatttctcatttcaaaacatgcagtatactctcttcatttgccaactaattatatctatacttttgatactgatagacgtttcttt |
200 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||| ||||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42692839 |
gatcgttcaaataacatttctcattttgaaacatgtagtatactctcttgatttgccaacaaattctatctatacttttgatactgatagacgtttcttt |
42692740 |
T |
 |
| Q |
201 |
tt---taaaaaagatccaggatacttcagaaaaagatccaggagaagcctttcaattagttagcatcaactttttcctcttatttattgttgcatgcata |
297 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42692739 |
taatataaaaaagatccaggatacttcagaaaaagatccaggggaagcctttcaattagttagcatcaactttttcctcttatttattgttgcatgcata |
42692640 |
T |
 |
| Q |
298 |
acgtgcgacgtgcatatatcgtgtgcctcgtgcaaaaaac |
337 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42692639 |
acgtgcgacgtgcatatatcgtgtgcctcgtgcaaaaaac |
42692600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University