View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16023_high_16 (Length: 338)
Name: NF16023_high_16
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16023_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 19 - 326
Target Start/End: Complemental strand, 53331710 - 53331403
Alignment:
| Q |
19 |
gagatgaatggtcaaaaccactagttcatgaaatgtaaaatggccaaccaagcatggttcacttcccccttggccctccacgtgcctcaacatctgagtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
53331710 |
gagatgaatggtcaaaaccactagtttatgaaatgtaaaatggccaaccaagcatggttcacttcccccttggccctccatgtgcctcaacatctgagtt |
53331611 |
T |
 |
| Q |
119 |
tgaagacttgagtgcaagaatggctttataaaatggatcaatttgcctcccaatattttagaataacattatgataaactggtaatagagcagtgcaaca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53331610 |
tgaagacttgagtgcaagaatggctttataaaatggatcaatttgcctcccaatattttagaataacattatgataaactggtaatagagcagtgcaaca |
53331511 |
T |
 |
| Q |
219 |
aggcgacatttaaaggctatatatttaagtagagataacaaacaataattgatctcccaagttaacttaatcaaaatatatggatgctaacaagttaact |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53331510 |
aggcgacatttaaaggctatatatttaagtagagataacaaacaataattgatctcccaagttaacttaatcaaaatatatggatgctaacaagttaact |
53331411 |
T |
 |
| Q |
319 |
tccccctt |
326 |
Q |
| |
|
|||||||| |
|
|
| T |
53331410 |
tccccctt |
53331403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University