View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16023_high_26 (Length: 238)
Name: NF16023_high_26
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16023_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 150 - 221
Target Start/End: Original strand, 34218610 - 34218681
Alignment:
| Q |
150 |
gaaatgcctaacgccgaataaatgccatgacatgacaagattaaggctatggttgagagtttattacgttca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34218610 |
gaaatgcctaacgccgaataaatgccatgacatgacaagattaaggctatggttgagagtttattacgttca |
34218681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 34218477 - 34218548
Alignment:
| Q |
18 |
gcaatgtcctaacaacatgtatattacggctactccaataaatttcaccaacttgatctcattcattggttg |
89 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34218477 |
gcaatgccctaacaacatgtatattacggctactccaataaatttcaccaacttgatctcattcattggttg |
34218548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University