View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16023_low_11 (Length: 390)
Name: NF16023_low_11
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16023_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 4 - 248
Target Start/End: Original strand, 48565205 - 48565444
Alignment:
| Q |
4 |
gcagtatcataggaaagcaaatgcataccgattcacttggtagtttaataaaattattttttgttagttcatattgatttacattatcttgcggtgcaaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565205 |
gcagtatcataggaaagcaaatgcataccgattcacttggtagtttaataaaattattttttgttagttcatattgatttacattatcttgcggtgcaaa |
48565304 |
T |
 |
| Q |
104 |
cttataaaaactaaacatttgatgacttctgcatgctaactaacataagtctttttcatttaatctgagttatttaaataccgctagtgaatttccgaga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48565305 |
cttataaaaactaaacatttgatgacttctacatgctaactaacataagtc-ttttcatttaatctgag----ttaaataccgctagtgaatttccgaga |
48565399 |
T |
 |
| Q |
204 |
tttctacagtctagtctaaccatgatgaccaaaggcttattctat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565400 |
tttctacagtctagtctaaccatgatgaccaaaggcttattctat |
48565444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 260 - 320
Target Start/End: Original strand, 48565488 - 48565548
Alignment:
| Q |
260 |
tgagggatgggaaattgaatcatcatatttgaagtgtgtgcaatctccctcttttttctct |
320 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565488 |
tgaggtatgggaaattgaatcatcatatttgaagtgtgtgcaatctccctcttttttctct |
48565548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University