View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16023_low_16 (Length: 348)
Name: NF16023_low_16
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16023_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 8e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 167 - 343
Target Start/End: Original strand, 4661905 - 4662081
Alignment:
| Q |
167 |
gtttaagtggaaggtgaaacaatcaaagactgtttaaactgtatcagtcagcattatatttacatatagttctagtttcaaagtattatgacaagcatag |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4661905 |
gtttaagtggaaggtgaaacaatcaaagactgtttaaactgtatcagtcagcattatatttatatatagttctagtttcaaagtattatgacaagcataa |
4662004 |
T |
|
| Q |
267 |
tatgaaacttggttatgcttgtgcagtgtgaatgtttcagtttttcccatattaattgttttctttgtcagtctctg |
343 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4662005 |
catgaaacttggttatgcttgtgcagtgtgaatgtttcagtttttcccatattaattgttttctttgtcagtgtctg |
4662081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 16 - 146
Target Start/End: Original strand, 4661739 - 4661869
Alignment:
| Q |
16 |
ggatggtcattacatggctgatggtccctaccgtttagggccatgattatgatatatgaagcgttgacactgacacatcgacaccaatgtcggcgtggtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4661739 |
ggatggtcattacatggctgatggtccctaccgtttagggccatgattatgatatatgaagcgttgacactggcacatcgacaccaatgtcggcgtggtg |
4661838 |
T |
|
| Q |
116 |
gtcggacttatcttcaatattatgaccactt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4661839 |
gtcggacttatcttcaatattatgaccactt |
4661869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University