View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16023_low_20 (Length: 288)
Name: NF16023_low_20
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16023_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 48568151 - 48567921
Alignment:
| Q |
17 |
tgtgaacaaatatcaaagtttattatttttacatcaaaaacacatccaataagtgggatctagcaaataagtcaaatttttgttcttttcttatttccat |
116 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568151 |
tgtgaaaaaatatcaaagtttattatttttacatcaaaaacacatccaataagtgtgatctagcaaataagtcaaatttttgttcttttcttatttccat |
48568052 |
T |
 |
| Q |
117 |
tcttaattctgtttacatcatttcaactctcttgaggctttcaaatatgcttggatatctctttcaaattaatcaattttgaatgacctaaaatgttaac |
216 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48568051 |
tcttaattctgtttaaatcatttcaactctcttgaggctttcaaatatgctcggatatctctttcaaattaatcaattttgaatgacctaaaatgttaac |
48567952 |
T |
 |
| Q |
217 |
tatagacctgctcttaagtacttataccttg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48567951 |
tatagacctgctcttaagtacttataccttg |
48567921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 243 - 273
Target Start/End: Complemental strand, 48565601 - 48565571
Alignment:
| Q |
243 |
ccttgtgaagagaggacgaaccagtgacata |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
48565601 |
ccttgtgaagagaggacgaaccagtgacata |
48565571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University