View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16023_low_26 (Length: 240)
Name: NF16023_low_26
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16023_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 14 - 221
Target Start/End: Original strand, 28521596 - 28521804
Alignment:
| Q |
14 |
cacagaccaaattttgcaacgcgcagtgagggaaaatattcatcctagcttgtgtgactaaggctctatcgagcctctcctcaaccacataattcgaact |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28521596 |
cacacaccaaattttgcaacgcgcagtgagggaaaatattcatcctagcttgtgtgactaaggctctatcgagcctctcctcaaccacataattcgaact |
28521695 |
T |
 |
| Q |
114 |
-aatttccgagatgatgtatatgcatgtccttgtagaggaacatcgatgaattcacaatcacttactacttcccggaaaccattgaagagccattaaggg |
212 |
Q |
| |
|
||| | | |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28521696 |
aaatcttcaagatgatgtatatgcatgtccttgtagatgaacatcgatgaattcacaatcacttactacttcctggaaaccattgaagagccattaaggg |
28521795 |
T |
 |
| Q |
213 |
tggggaaca |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
28521796 |
tggggaaca |
28521804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University