View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16023_low_29 (Length: 238)
Name: NF16023_low_29
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16023_low_29 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 9232444 - 9232224
Alignment:
| Q |
18 |
ctcaacacgatactcaaacaatgatggttccaaaacagcatacacatgattagtactactattcccatgtctgctacaacgactcgtgtccaccttaacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9232444 |
ctcaacacgatactcaaacaatgatggttccaaaacagaatacacatgattagtactactattcccatgtctgctacaacgactcgtgtccaccttaacg |
9232345 |
T |
 |
| Q |
118 |
taccgtggatcttttattggacttgaacaattgaaatacgctattctcaatggatttattggatccagaatgaacggttcagatccaaaattgtcttcgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9232344 |
taccgtggatcttttattggacttgaacaattgaaatacgctattctcaatggatttattggatccagaatgaacggttcagatccaaaattgtcttctc |
9232245 |
T |
 |
| Q |
218 |
caaaaagaacattattaaaac |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
9232244 |
caaaaagaacattattaaaac |
9232224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 9386218 - 9386340
Alignment:
| Q |
38 |
atgatggttccaaaacagcatacacatgattagtactactattcccatgtctgctacaacgactcgtgtccaccttaacgtaccgtggatcttttattgg |
137 |
Q |
| |
|
||||| |||||||||| ||||| ||||||||||||||||||||||||||| || |||||| ||| ||||||| ||||| ||| ||||||| ||||| |
|
|
| T |
9386218 |
atgattgttccaaaactgcatatacatgattagtactactattcccatgtatgttacaacagctcatgtccacgttaacatacatatgatctttaattgg |
9386317 |
T |
 |
| Q |
138 |
acttgaacaattgaaatacgcta |
160 |
Q |
| |
|
| | ||||||||||||||||||| |
|
|
| T |
9386318 |
attagaacaattgaaatacgcta |
9386340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University