View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16023_low_34 (Length: 218)
Name: NF16023_low_34
Description: NF16023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16023_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 53 - 212
Target Start/End: Original strand, 9416418 - 9416577
Alignment:
| Q |
53 |
ctgatggcatggtccactcggtccatgaatggaagcttccattacgtgtgttaagagacaatttgatttgttcttcaaataaaacaaagttgggtttccg |
152 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9416418 |
ctgatggcatggtccactcggtcgatgaatggaagcttccattacgtgtgttaagagacaatttgatttgttcttcaaataaaacaaagttgggtttccg |
9416517 |
T |
 |
| Q |
153 |
acttagctcggttgacaagtttttccaattttcccaaacgaccatttcttttcttctcac |
212 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
9416518 |
acttagctcggttgacaagtttttccatctttcccaaacgaccatttcttttcttttcac |
9416577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University