View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16024_low_4 (Length: 385)
Name: NF16024_low_4
Description: NF16024
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16024_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 83 - 383
Target Start/End: Complemental strand, 2628769 - 2628462
Alignment:
| Q |
83 |
ggacgcgaatttgtggccacgagtata--cataaaataaaactagaactagaattggtagaaggctttctcattagcacatgtgttttgtacaccttgct |
180 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2628769 |
ggacgcgaatttgtggccacgagtatatacataaaataaaactagaactagaattggtagaaggctttctcattagcacatgtgttttgtacaccttgct |
2628670 |
T |
|
| Q |
181 |
ttatttgttgatttaatcaaaagtggggagtgttgtgttgtgttgttggtaagcttgttgagtcaaccccaatggattgaatccccttacaagactctag |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
2628669 |
ttatttgttgatttaatcaaaagtggggagtgttgtgttgtgttgttggtaagcttgttgagtcaaccccaatggattggatcctcttacaagactctag |
2628570 |
T |
|
| Q |
281 |
atgatctatgatctatccgatatgcacatatattctttagattagacgtgtcctaatgttgaacatgt-----gtcggacacatgcatttataattacac |
375 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||| ||||||| | ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2628569 |
atgatctatgatctattcgatatgcatatatattctttagattaaacgtgtcttgatgttgaacatgtgtcgtgtcggacacatgcatttataattacat |
2628470 |
T |
|
| Q |
376 |
tgaattat |
383 |
Q |
| |
|
|||||||| |
|
|
| T |
2628469 |
tgaattat |
2628462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University