View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16025_high_2 (Length: 413)
Name: NF16025_high_2
Description: NF16025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16025_high_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 17 - 403
Target Start/End: Original strand, 40839123 - 40839509
Alignment:
| Q |
17 |
acatagtagcatagaagaaaaaggattgttaccgatcgaaggaaactcagtttctgtccccggctgcgaccatcgggggaagtcaagtctatagtctcag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40839123 |
acatagtagcatagaagaaaaaggattgttaccgatcgaaggaaactcagcttctgtccccggctgcgaccatcggttgaagtcaagtctatagtctcag |
40839222 |
T |
 |
| Q |
117 |
tgctatctacattgtgaagagttgttggatggcccaaaggtctctgacccctaacattattcccaacttgccaaacatggttcaaccttgttatgttata |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839223 |
tgctatctacattgtgaagagttgttggatggcccaaaggtctctgacccctaacattattcccaacttgccaaacatggttcaaccttgttatgttata |
40839322 |
T |
 |
| Q |
217 |
tttatcagaaggcaaaactaatctagcatagatagtataaaaatttgacccttgatcatgttgaatcgacatatctgacacattaaggccaatatcggta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839323 |
tttatcagaaggcaaaactaatctagcatagatagtataaaaatttgacccttgatcatgttgaatcgacatatctgacacattaaggccaatatcggta |
40839422 |
T |
 |
| Q |
317 |
ggtaaaagactgcaacctcttttggttcctttagtaacatcataggtaccaactggcaaatatgtaccatggtatctgatccctatg |
403 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40839423 |
ggtaaaagactacaacctcttttggttcctttagtaacatcataggtaccaactggcaaatatgtaccatggtatctgatccctatg |
40839509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University