View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16026_low_12 (Length: 229)
Name: NF16026_low_12
Description: NF16026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16026_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 71 - 213
Target Start/End: Complemental strand, 37616267 - 37616125
Alignment:
| Q |
71 |
atagcattcctttatttcatccatactatttggatcctgtgaatatctgcttttatctccctataactttctatgatagactcaaaagttaagatttgtt |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37616267 |
atagcattcctttatttcatccatactatttggatcctgtgaatatctgcttttatctccctataactttctatgatagactcaaaagttaagatttgtt |
37616168 |
T |
|
| Q |
171 |
gaatcacatgttctccatttacattattgttttaattttgttt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37616167 |
gaatcacatgttctccatttacattatttttttaattttgttt |
37616125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 37616387 - 37616319
Alignment:
| Q |
1 |
tatttaatgtacgtttcgtatcacggtgagtatatcagaatcaccgcgatccattgtgattttgcaaaa |
69 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
37616387 |
tatttaatgtacgtttaatatcacggtgagtatatcagaatcaccgcgatccatcgtaattttgcaaaa |
37616319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University