View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16026_low_7 (Length: 337)
Name: NF16026_low_7
Description: NF16026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16026_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 35 - 324
Target Start/End: Complemental strand, 45349731 - 45349439
Alignment:
| Q |
35 |
tttaattaatcatcatcctctttgttttctttcgttctttctttacttgccattttaatctgcaaaacataaaataatcttcaagtgatgctaacttaca |
134 |
Q |
| |
|
||||||||||| ||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45349731 |
tttaattaatcttcatcctgtctgttttctttcgttctttctttacttgccattttaatctgtaaaacataaaataatcttcaagtgatgctaacttaca |
45349632 |
T |
|
| Q |
135 |
agcaaacattatccacagtcatgaaacaaaaactagtgttatattggatgtcactaaggattcatttgcacattgactttgatgcattggattttactac |
234 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45349631 |
agcaaacattatccacagtcatcaaacaaaaactggtgttatattggatgtcactaaggattcatttgcacattgactttgttgcattggattttactac |
45349532 |
T |
|
| Q |
235 |
----tattaatttttcgtcgattcctaaatatagtatatactgaattaggatatttaattccggaatttaaaagtctattcggttcataatttc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
45349531 |
tatatattaatttttcgtcgattcctaaatatagtatatactgaattagg-tatttaattccggaatttaaaactctatggggttcataatttc |
45349439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University