View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16026_low_9 (Length: 294)
Name: NF16026_low_9
Description: NF16026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16026_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 22 - 289
Target Start/End: Complemental strand, 2558383 - 2558117
Alignment:
| Q |
22 |
catgcatgtgacaaattataattgaagagtaatatatattgacaaaatttataagtaagccattcaaaattttcattattttgaaagcaaaatcgtaaaa |
121 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2558383 |
catgcacgtgacaaattataattgaagtgtaatatatattgacaaaatttataagtaagccatccaaaattttcattattttgaaagcaaaatcgtaaaa |
2558284 |
T |
|
| Q |
122 |
gttatttgcatgaaaaaagtagtttattttgtgcacacattttagatcactcgttnnnnnnnnnnnnnnnntgtcagatgactcaaactaccataaacgt |
221 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||||||||| |
|
|
| T |
2558283 |
gttatttgcatgaaaatagtagtttattttgtgcacacattttagatcactcgtt-aaaaaaaataaaaaatgccatatgactcaaactaccataaacgt |
2558185 |
T |
|
| Q |
222 |
catccttcaatctttaagttcaaactaaagcatgttttaatgatagatcataacatcttcttctctct |
289 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
2558184 |
catacttcaatctttaagttcaaactaaagcatgttttaatgatagatcataacatctacatctctct |
2558117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University