View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16027_high_16 (Length: 222)
Name: NF16027_high_16
Description: NF16027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16027_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 88 - 205
Target Start/End: Complemental strand, 27778332 - 27778215
Alignment:
| Q |
88 |
ccaagattgtcagtattggactctgccagatggtatttgctgcacgaaattttcttccttgtcccttagaatcatccctattcctacgccttgttgatta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27778332 |
ccaagattgtcagtattggactctgccaaatggtatttgctgcacgaaattttcttccttgtcccttagaatcatccctattcctacgccttgttgatta |
27778233 |
T |
 |
| Q |
188 |
ggacttaggagcaaaacc |
205 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
27778232 |
ggacttaggagcaaaacc |
27778215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 17 - 91
Target Start/End: Complemental strand, 27778439 - 27778365
Alignment:
| Q |
17 |
cataggcctatatgcttcaataatgacgccaaaatatgaaacataaactcttaaaacaatattttgaaaacccaa |
91 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
27778439 |
cataggcctatatgcttcaataatgacaccaaaatatgaaacattaactcttaaaacaatattttgaaaccccaa |
27778365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 17 - 68
Target Start/End: Complemental strand, 3796724 - 3796673
Alignment:
| Q |
17 |
cataggcctatatgcttcaataatgacgccaaaatatgaaacataaactctt |
68 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| || ||||||| |
|
|
| T |
3796724 |
cataggcctatatgcttcaataatgacaccaaaatatgaaatattaactctt |
3796673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University