View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16027_low_11 (Length: 269)
Name: NF16027_low_11
Description: NF16027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16027_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 15 - 267
Target Start/End: Complemental strand, 251615 - 251365
Alignment:
| Q |
15 |
atgaagccaatgtaattctcattgttgtttgtatactctgacacaaaacaaatggttttataaagttgcatacacattgcatcatctcaaagtaaacttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
251615 |
atgaagccaatgtaattctcattgttgtttgtttactctgacacaa--caaatagttttataaagttgcatacacattgcatcatctcaaagtaaacttt |
251518 |
T |
 |
| Q |
115 |
gtcataagtcattgtttgaccataaacttatctctattatgactcacaaatatgaatgtgagattgttttctatcataagtcattgtttggatgaatcac |
214 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
251517 |
attataagtcattgtttgaccataaacttatctctattatgactcacaaatatgaatgtgagattgttttctatcataagtcattgtttggatgaatcac |
251418 |
T |
 |
| Q |
215 |
tcaatgtcaaaacactcaccctacaatattaacaatcttctattcggtgtatg |
267 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
251417 |
tcaatgtcaaaacactcaccctacaacattaacaatcttctattcggtgtatg |
251365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University