View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16027_low_15 (Length: 242)
Name: NF16027_low_15
Description: NF16027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16027_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 108 - 236
Target Start/End: Complemental strand, 35454034 - 35453906
Alignment:
| Q |
108 |
ctgatcttgttcagttattgcgtggaattttcttagttgaattatgggaaggttgtttgttgttcatcttgaagggaggatctatagctgtaaacactgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35454034 |
ctgatcttgttcagttattgcgtggaattttcttagttgaattatgggaaggttgtttgttgttcatcttgaagggaggatgtatagctgtaaacactgt |
35453935 |
T |
 |
| Q |
208 |
agaacacctcttgctctttgtgatgatgt |
236 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
35453934 |
agaacacctcttgctctttgtgaagatgt |
35453906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University