View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16027_low_17 (Length: 234)
Name: NF16027_low_17
Description: NF16027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16027_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 1784878 - 1784668
Alignment:
| Q |
13 |
atattttttaccgtgtaaattattttaatcatcttctaataacattatttaattttatagatattacttgtaattctgcccttgattgtgcaagtaatcg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1784878 |
atattttttaccgtgtaaattattttaatcatcttctaataacattatttaattttatagatattacttgtaattctgcccttgattgtgcaagtaatcg |
1784779 |
T |
|
| Q |
113 |
atgtattttacctggaatgccgatatgcgtaacaaataaatgtttatgtgtttaacaggtaattagttaaaaatgattctattacttcttaacttattat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1784778 |
atgtattttacctggaatgccgatatgcgtaacaaataaatgtttatgtgtttagcaggtaattagttaaaaatgattctattacttcttaacttattat |
1784679 |
T |
|
| Q |
213 |
tcttttttcat |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
1784678 |
tcttttttcat |
1784668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University