View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16027_low_8 (Length: 307)
Name: NF16027_low_8
Description: NF16027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16027_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 289; Significance: 1e-162; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 297
Target Start/End: Complemental strand, 52771151 - 52770855
Alignment:
| Q |
1 |
gcattctcaaatcaaacctcagcagcagcatcaaatgctaccggatggcttgcagttttgggtttgatactgtatatagcttttttctcccctgggatgg |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52771151 |
gcattctcaaatcaaacctcggcagcagcatcaaatgctaccggatggcttgcagttttgggtttgatactgtatatagcttttttctcccctgggatgg |
52771052 |
T |
|
| Q |
101 |
gaccagtgccgtgggcaatgaactcagagatatatcctaaagaatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52771051 |
gaccagtgccgtgggcaatgaactcagagatatatcctaaagaatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcat |
52770952 |
T |
|
| Q |
201 |
tgtgtctcagacatttctttctgttgctgaagctttagggactggtcctactttcttgattcttgctgtaataaccgtgcttgcctttttatctgtg |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52770951 |
tgtgtctcagacatttctttctgttgctgaagctttagggactggtcctactttcttgattcttgctgtaataaccgtgcttgcctttttatttgtg |
52770855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 43 - 267
Target Start/End: Complemental strand, 52767145 - 52766921
Alignment:
| Q |
43 |
ggatggcttgcagttttgggtttgatactgtatatagcttttttctcccctgggatgggaccagtgccgtgggcaatgaactcagagatatatcctaaag |
142 |
Q |
| |
|
||||||||||| ||| | |||||| || ||||| || |||||||| || |||||||| || |||||||||||| | ||||| || ||||||| | | |
|
|
| T |
52767145 |
ggatggcttgcggttgttggtttggccctatatattgcatttttctcgccagggatggggcctgtgccgtgggcagtaaactctgaagtatatccgcagg |
52767046 |
T |
|
| Q |
143 |
aatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcattgtgtctcagacatttctttctgttgctgaagctttagggac |
242 |
Q |
| |
|
| || ||||||| ||||| || ||||||||||||||| |||| |||| ||| | |||||| ||||| |||||||||| |||| |||||| |||||| |
|
|
| T |
52767045 |
agtaccgaggaatgtgtggagggatgtcagctactgtgaattggatttcaaatttgattgtggctcagtcatttctttccattgcagaagctgcagggac |
52766946 |
T |
|
| Q |
243 |
tggtcctactttcttgattcttgct |
267 |
Q |
| |
|
||||||||| |||||| |||||||| |
|
|
| T |
52766945 |
tggtcctacattcttgcttcttgct |
52766921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 121 - 269
Target Start/End: Original strand, 392778 - 392926
Alignment:
| Q |
121 |
aactcagagatatatcctaaagaatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcattgtgtctcagacatttcttt |
220 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| || ||||| || ||| |||| || ||||||||| |||| ||| | || ||||| ||| ||||||| |
|
|
| T |
392778 |
aactcagagatatatcctgaagaatatcgaggtatatgtgggggcatggcagcgaccgtgtgttggatttcaaatttgatcgtgtccgagagctttcttt |
392877 |
T |
|
| Q |
221 |
ctgttgctgaagctttagggactggtcctactttcttgattcttgctgt |
269 |
Q |
| |
|
| ||||||| ||| | |||| || | | |||||||||||| ||||||| |
|
|
| T |
392878 |
cgattgctgacgctatcgggattgcttcaactttcttgattattgctgt |
392926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University