View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16028_high_5 (Length: 231)
Name: NF16028_high_5
Description: NF16028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16028_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 30 - 216
Target Start/End: Original strand, 6938307 - 6938493
Alignment:
| Q |
30 |
aaaggtagcgtcccaaatggtgaaaaattgaggtaatttctggaaacattttgtttaactctttttcgaaaattggtgtcatgaaaaatgaaggtataaa |
129 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| | |||||| |||||||||||||| || |||| ||| |
|
|
| T |
6938307 |
aaaggtaacgtcccaaatggtgaaaagttgaggtgatttctggaaacattttgtttaactctttcttgaaaatcggtgtcatgaaaaaagagggtacaaa |
6938406 |
T |
 |
| Q |
130 |
atactcacctgcatcgaaaaacaacagaggaattttactgagaagaaattgactgtggtcacagtgaaaaaatctctcatcagatgt |
216 |
Q |
| |
|
||||| |||||| || |||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||| || ||||| |
|
|
| T |
6938407 |
atactgacctgcttccaaaaacaaaagaggaatattactgagaagaaattggttgtggtcacagtgaaaaaatctctcttctgatgt |
6938493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 114 - 216
Target Start/End: Complemental strand, 1036439 - 1036337
Alignment:
| Q |
114 |
aaaatgaaggtataaaatactcacctgcatcgaaaaacaacagaggaattttactgagaagaaattgactgtggtcacagtgaaaaaatctctcatcaga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1036439 |
aaaatgaaggtataaaatactcacctgcatcgaaaaacaacagaggaattttactgagaagaaattgactgtggtcacagtgaaaaaatctctcatcaga |
1036340 |
T |
 |
| Q |
214 |
tgt |
216 |
Q |
| |
|
||| |
|
|
| T |
1036339 |
tgt |
1036337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University