View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16028_low_7 (Length: 214)
Name: NF16028_low_7
Description: NF16028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16028_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 32008622 - 32008439
Alignment:
| Q |
19 |
acaagagggagtaagagattagacaacttttttgcatactgtttgatttataaataaaccatgagagtacgtacgagactgtaaaaagacatga--tttt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| | |||||||||||||||||||||| |||||| |||| |
|
|
| T |
32008622 |
acaagagggagtaagagattagacaacttttttgcatacggtttgatttataaataaatcataacagtacgtacgagactgtaaaaa-acatgatttttt |
32008524 |
T |
 |
| Q |
117 |
ttatcattaactaaaccataaaacaaccttttatctacaaaaataccatttttctctaacatagaaagtattatatcttcatctc |
201 |
Q |
| |
|
|||| |||||||||||||||||| ||| ||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32008523 |
ttatgattaactaaaccataaaataactttttatctatgaaaataccatttttctctaacatagaaaatattatatctttatctc |
32008439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University