View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16028_low_7 (Length: 214)

Name: NF16028_low_7
Description: NF16028
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16028_low_7
NF16028_low_7
[»] chr5 (1 HSPs)
chr5 (19-201)||(32008439-32008622)


Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 32008622 - 32008439
Alignment:
19 acaagagggagtaagagattagacaacttttttgcatactgtttgatttataaataaaccatgagagtacgtacgagactgtaaaaagacatga--tttt 116  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| | |||||||||||||||||||||| ||||||  ||||    
32008622 acaagagggagtaagagattagacaacttttttgcatacggtttgatttataaataaatcataacagtacgtacgagactgtaaaaa-acatgatttttt 32008524  T
117 ttatcattaactaaaccataaaacaaccttttatctacaaaaataccatttttctctaacatagaaagtattatatcttcatctc 201  Q
    |||| |||||||||||||||||| ||| |||||||||  |||||||||||||||||||||||||||| ||||||||||| |||||    
32008523 ttatgattaactaaaccataaaataactttttatctatgaaaataccatttttctctaacatagaaaatattatatctttatctc 32008439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University