View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16029_high_16 (Length: 290)
Name: NF16029_high_16
Description: NF16029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16029_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 11 - 276
Target Start/End: Complemental strand, 37565972 - 37565707
Alignment:
| Q |
11 |
cagtcccaaagctgcagctaagaagatgataagacaccttcttagcaagtcaatccgcacctttgtttcttttccctgtagtatgatggagagaaatggt |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37565972 |
cagtcccaaagctgcagccaagaagatgataagacaccttcttagcaagtcaatccgcacctttgtttcttttccctgtagtatgatggagagaaatggt |
37565873 |
T |
 |
| Q |
111 |
ccactgtctagacataagctatgtagcaccggcgcttctaatcaatgccgtgcttagtgtccgaaacgtgtgtcagcgtctgaattgatgtatgcgattg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37565872 |
ccactgtctagacataagctatgtagcaccggcgcttctaatcaatgacgtgcttagtgtctgaaacgtgtgtcagcgtctgaattgatgtatgcgattg |
37565773 |
T |
 |
| Q |
211 |
cagtcaatcatgtcattttcaatgtctgtttctatgtcaatacttcacaagacataagtctacaat |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37565772 |
cagtcaatcatgtcattttcaatgtctgtttctatgtcaatacttcacaagacataagtctacaat |
37565707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University