View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16029_high_18 (Length: 278)
Name: NF16029_high_18
Description: NF16029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16029_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 4e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 69 - 258
Target Start/End: Original strand, 46635060 - 46635231
Alignment:
| Q |
69 |
caatttgcacaaacccataacttagcactgagagagttttgtgggtgatgataattgcaacccaattacaaaccttaaatccccaaattagttttcccca |
168 |
Q |
| |
|
|||||||||||||||||| ||||||| | ||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46635060 |
caatttgcacaaacccatggcttagcagtaagaaagttttgtgggtgatgataattgcaactcaattgcaaaccttaaatccccaaattagttttcccca |
46635159 |
T |
 |
| Q |
169 |
attttgaatttaaaattgttgtttttgtaatttcaggtgttgtagtgaagaaaagggagaatgaaatgaatttatagggaagatgatgaa |
258 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
46635160 |
attttaaatttaaaattgttgtt------------------gtagtgaagaaaagggataatgaaatgaatttagagggaagatgatgaa |
46635231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University