View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16029_low_25 (Length: 228)
Name: NF16029_low_25
Description: NF16029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16029_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 39036572 - 39036384
Alignment:
| Q |
1 |
ctccattattgagatataaggagggaaaatttaatgcgatggctaattttaataaaataatagtaatgttttgcagccaatcaataattaaatgtttgga |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39036572 |
ctccattattgagacataaggagggaaaatttaatgcgatggctaattttaataaaataatagtaatgttttgcagccaatcaataattaaatgtttgga |
39036473 |
T |
 |
| Q |
101 |
caaatgaaatttgattaaattgataaggatacaactcatgttttgtgtaatgtgcataaggagatacaaattcatgcaacatgtacaag |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39036472 |
caaatgaaatttgattaaattgataaggatacaactcatgttttgtgtaatgtgcataaggagatacaaattcatgcaacatgtacaag |
39036384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University