View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_high_17 (Length: 388)
Name: NF1602_high_17
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_high_17 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 1 - 388
Target Start/End: Original strand, 42521993 - 42522380
Alignment:
| Q |
1 |
acatgtcattttctcttgcattctcttcatatagtattcttagtttcttacactgcagatgatgaaagatgatttttcttaactagaatcacgtatgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42521993 |
acatgtcattttctcttgcattctcttcatatagtattcttagtttcttacactgcagatgatgaaagattatttttcttaactagaatcacgtatgcat |
42522092 |
T |
 |
| Q |
101 |
tgactatatctccagtggcaatgagtcttgaagagttgataccagcaaaccatgccaagtcttacctattttccattttcatcagaacaggccttgtatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42522093 |
tgactatatctccagtggcaatgagtcttgaagagttgataccagcaaaccatgccaagtcttacctattttccattttcatcagaacaggccttgtatt |
42522192 |
T |
 |
| Q |
201 |
ttctacccttgttattggtctctcagttcccttttttggtgagtcttaatcaatgagttgtatgatataattaagataatcaattgcattagtttcttaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42522193 |
ttctacccttgttattggtctctcagttcccttttttggtgagtcttaatcaatgagttgtatgatataattaagataaccaattgcattagtttcttaa |
42522292 |
T |
 |
| Q |
301 |
tcaatcaatcattgtaatgtgacatagttgcactatgctatggcaaattggcaataacatgtctaattattctttgcaggtttggtga |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42522293 |
tcaatcaatcattgtaatgtgacatagttgcactatgctatggcaaattggcaataacatgtctaattattctttgcaggtttggtga |
42522380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University