View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_high_33 (Length: 287)
Name: NF1602_high_33
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_high_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 11 - 271
Target Start/End: Complemental strand, 41656540 - 41656280
Alignment:
| Q |
11 |
gagacaaaatggaatgaacctctcattaggcatatctttagtcatgacattgctgctgtcatattaaatatgcctctgattgttcaggtacagcaggata |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41656540 |
gagaaaaaatggaatgaacctctcattaggcatatctttagtcatgacattgctgctgtcatattaaatatgcctctgattgttcaggtacagcaggata |
41656441 |
T |
 |
| Q |
111 |
aggtcatttggaaagcggaaaggaacgggaaatattctgtatgtagcgcgtatagactgtgtattgaggaattaattgatacgtctcatttacggcaccc |
210 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41656440 |
agctcatttggaaagcggaaaggaacgggaaatattctgtatgtagcgcgtatagactgtgtgttgaggaattaattgatacgtctcatttacggcaccc |
41656341 |
T |
 |
| Q |
211 |
ggggtattggtcaggtatttggaggttaaaggttccgccaaaggttagaaatttaatttgg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41656340 |
ggggtattggtcaggtatttggaggttaaaggttccgccaaaggttagaaatttaatttgg |
41656280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University