View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1602_high_40 (Length: 253)

Name: NF1602_high_40
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1602_high_40
NF1602_high_40
[»] chr7 (1 HSPs)
chr7 (3-237)||(20152717-20152949)


Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 3 - 237
Target Start/End: Complemental strand, 20152949 - 20152717
Alignment:
3 gagaggctcaacttcattgagctctttgcacaccctaaaattcggctctgtctatattttctatagatnnnnnnnnnnnnnnngttaaattggtgaaatt 102  Q
    |||||||||| || |||||||||||||||||||||||||||||| || |||||||||| ||| | ||                |||||||||||||||||    
20152949 gagaggctcagctccattgagctctttgcacaccctaaaattcgactatgtctatattgtctgttgaaagaaaaaaaatatcagttaaattggtgaaatt 20152850  T
103 aagtgtcttctccaccttttttaatgtgtgaacnnnnnnngagagataattgaagtaatgaaaatctgnnnnnnnnaagatggacaaaatctcaataatt 202  Q
    |||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||        ||||| |||||||||||||||| |    
20152849 aagtgtcttctccaccttttttaatgtgtgaac-ttttttgagagataattgaagtaatgaaaatctg-tttttttaagatagacaaaatctcaataact 20152752  T
203 atttgagaacttatacgtataaataaagaagttaa 237  Q
    |||||||||||||||||||| ||| ||||||||||    
20152751 atttgagaacttatacgtatgaatgaagaagttaa 20152717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University