View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_high_40 (Length: 253)
Name: NF1602_high_40
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_high_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 3 - 237
Target Start/End: Complemental strand, 20152949 - 20152717
Alignment:
| Q |
3 |
gagaggctcaacttcattgagctctttgcacaccctaaaattcggctctgtctatattttctatagatnnnnnnnnnnnnnnngttaaattggtgaaatt |
102 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||| || |||||||||| ||| | || ||||||||||||||||| |
|
|
| T |
20152949 |
gagaggctcagctccattgagctctttgcacaccctaaaattcgactatgtctatattgtctgttgaaagaaaaaaaatatcagttaaattggtgaaatt |
20152850 |
T |
|
| Q |
103 |
aagtgtcttctccaccttttttaatgtgtgaacnnnnnnngagagataattgaagtaatgaaaatctgnnnnnnnnaagatggacaaaatctcaataatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||| | |
|
|
| T |
20152849 |
aagtgtcttctccaccttttttaatgtgtgaac-ttttttgagagataattgaagtaatgaaaatctg-tttttttaagatagacaaaatctcaataact |
20152752 |
T |
|
| Q |
203 |
atttgagaacttatacgtataaataaagaagttaa |
237 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |
|
|
| T |
20152751 |
atttgagaacttatacgtatgaatgaagaagttaa |
20152717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University