View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_high_44 (Length: 234)
Name: NF1602_high_44
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_high_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 104 - 219
Target Start/End: Complemental strand, 3310615 - 3310501
Alignment:
| Q |
104 |
gagcatatatctgctgttttttctctcctccttttggctatatgtttccatgatgttttattccattaacaggtatgcctcctttcctcagatctgattc |
203 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3310615 |
gagcatatatctgctgttttt-ctctcctccttttggctatatgtttccatgatgttttattccattaacaggtatgcctcctttcctcagatctgattc |
3310517 |
T |
 |
| Q |
204 |
agttattagtattttt |
219 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3310516 |
agttattagtattttt |
3310501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University