View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_low_17 (Length: 436)
Name: NF1602_low_17
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 396; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 396; E-Value: 0
Query Start/End: Original strand, 20 - 423
Target Start/End: Complemental strand, 2447022 - 2446619
Alignment:
| Q |
20 |
atccaccatttcatatatctccttatactgatcatgagacttatcacctgcaacaaactcatacatttcattgtttacctcaatcatggtactccctgga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2447022 |
atccaccatttcatatatctccttatactgatcatgagacttatcacctgcaacaaactcatacatttcattgtttacctcaatcatggtactccctgga |
2446923 |
T |
 |
| Q |
120 |
accttcttcatccctctcatatccatcatctccctcaccttagtcttcttctcccattgtcgcaatttcgcgtaaatgttcgacagcaaaacataattag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2446922 |
accttcttcatccctctcatatccatcatctccctcaccttagtcttcttctcccattgtcgcaatttcgcgtaaatgttcgacagcaaaacataattag |
2446823 |
T |
 |
| Q |
220 |
actcatgcatcggttcactttttagcagctctttggagatactctctccaagcttgagttccccagttgcatgacaagcagtgattatggttctccatat |
319 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
2446822 |
actcatgcatcggttcactttttatcagctctttggagatactctctccaagcttgagttccccagttgcatgacaagcggtgattatggttctccatat |
2446723 |
T |
 |
| Q |
320 |
gatctggtttggttcaaaaggcatcttttgaacaaactcaaatgcttctttaacaaacccacctctacaaagcaaatctaccatgcatccgtagtgttct |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2446722 |
gatctggtttggttcaaaaggcatcttttgaacaaactcaaatgcttctttaacaaacccacctctacaaagcaaatctaccatgcatccgtagtgttct |
2446623 |
T |
 |
| Q |
420 |
acct |
423 |
Q |
| |
|
|||| |
|
|
| T |
2446622 |
acct |
2446619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University