View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_low_30 (Length: 349)
Name: NF1602_low_30
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_low_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 14 - 121
Target Start/End: Complemental strand, 3225860 - 3225752
Alignment:
| Q |
14 |
atataacccaacaccctaaaaaatgattaaacaggtcataacaataactttgta-nnnnnnngttgaagaaacaaaaactctatacgattaaattgcaac |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3225860 |
atataacccaacaccctaaaaaatgattaaacaggtcataacaataactctgtattttttttgttgaagaaacaaaaactctatatgattaaattgcaac |
3225761 |
T |
|
| Q |
113 |
aataattca |
121 |
Q |
| |
|
||||||||| |
|
|
| T |
3225760 |
aataattca |
3225752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University