View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_low_41 (Length: 292)
Name: NF1602_low_41
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 20 - 285
Target Start/End: Original strand, 19373684 - 19373949
Alignment:
| Q |
20 |
gtcccgcttgggcagcaacgggagaatgtcaacgtaaccctgtctacatggttggatctcctgattactatggtacatgtcggaaaagctgcaatgcatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19373684 |
gtcccgcttgggcagcaacgggagaatgtcaacgtaaccctgtctacatggttggatctcctgattactatggtacatgtcggaaaagctgcaatgcatg |
19373783 |
T |
 |
| Q |
120 |
ctgatgagaagttggttttgcataannnnnnnnacgtggttgcttttttaatttgattggagaataggaacatatagtagagtgaattaactgatattct |
219 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19373784 |
ctgatgagaagttggttttgcataattttttttacgtggttgcttttttaatttgattggagaataggaacatatagtagagtgaattaactgatattct |
19373883 |
T |
 |
| Q |
220 |
caggatgttcttgagcaactatgatgttcctcaattaactaggcagtatattatttgcctttgctt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19373884 |
caggatgttcttgagcaactatgatgttcctcaattaactaggcagtatattatttgcctttgctt |
19373949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University