View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_low_47 (Length: 279)
Name: NF1602_low_47
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_low_47 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 6 - 256
Target Start/End: Original strand, 27425579 - 27425840
Alignment:
| Q |
6 |
gagagagaagaaagagaacgtcaccataggagagtcgtatttatgacaggcttatggtggccacgtgaaagagaagaatgagtgaatggttggtgattat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27425579 |
gagagagaagaaagagaacgtcaccataggagagccgcatttatgacaggcttatggtggccacgtgaaagagaagaatgagtgaatggttggtgattat |
27425678 |
T |
 |
| Q |
106 |
tcaagtttctaattgttcttttggtgacatgatttggagaagaagataaagttcaagaagggcaaatgctaaccata-----------atatatagcgaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27425679 |
tcaagtttctaattgttcttttggtgacatgatttggagaagaagataaagttcaagaagggcaaatgctaaccataaaggaactgttatatatagcgaa |
27425778 |
T |
 |
| Q |
195 |
atattggcatctagattgtggatggaaggtgagtaaaaacactttattcaatgttgcaactg |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27425779 |
atattggcatctagattgtggatggaaggtgagtaaaaacactttattcaatgttgcaactg |
27425840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University