View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_low_57 (Length: 239)
Name: NF1602_low_57
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_low_57 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 71 - 221
Target Start/End: Original strand, 31434730 - 31434886
Alignment:
| Q |
71 |
aaaaatgtaacagttcatatacaaaattcaaaggagacaatatctcacaaatgcta--------gtgaaaacacatgtctttccatattgatatgagata |
162 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31434730 |
aaaaatgtaacagttcata--caagattcaaaggagacaatatctcacaaatgctaacattgtagtgaaaacacatgtctttccatattgatatgagata |
31434827 |
T |
|
| Q |
163 |
tgagatgatttgtttatctcttagattaatttgcatccataaggagtgctagctagaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31434828 |
tgagatgatttgtttatctcttagattaatttgcatccataaggagtgctggctagaaa |
31434886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 31434638 - 31434702
Alignment:
| Q |
4 |
caatttgtcattgaattttgcctcaacgataatggtagtttgcaaacaacacccacacccttcaa |
68 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31434638 |
caatttgtcattgaattttgcctcaaggataatggtagtttgcaagcaacacccacacccttcaa |
31434702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University