View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_low_62 (Length: 233)
Name: NF1602_low_62
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_low_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 130; Significance: 2e-67; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 87 - 220
Target Start/End: Complemental strand, 37001967 - 37001834
Alignment:
| Q |
87 |
gacaggtgggcttccatacaagcaatcgagactgattccagtgcgaaaactaaggatttgatctcatattggatgcttctttccttaatttacctctttg |
186 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37001967 |
gacaggtgtgcttccatacaagcaatcgagactgattccagtgcgaaaactaaggatttgatctcatattggatgcttctttccttaatttacctctttg |
37001868 |
T |
 |
| Q |
187 |
agtatgcttttatggattttcttctgtggtaaat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
37001867 |
agtatgcttttatggattttcttctgtggtaaat |
37001834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 87 - 218
Target Start/End: Complemental strand, 36982610 - 36982479
Alignment:
| Q |
87 |
gacaggtgggcttccatacaagcaatcgagactgattccagtgcgaaaactaaggatttgatctcatattggatgcttctttccttaatttacctctttg |
186 |
Q |
| |
|
|||||||| |||||| |||||||||| || ||||| ||| ||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
36982610 |
gacaggtgtgcttccgtacaagcaattgaaactgactcctatgcagaaactaaggatttgatctcatattggatacttctctccttaatttacctctttg |
36982511 |
T |
 |
| Q |
187 |
agtatgcttttatggattttcttctgtggtaa |
218 |
Q |
| |
|
| |||||||||||| | ||||||| |||||| |
|
|
| T |
36982510 |
aatatgcttttatgaaccttcttctatggtaa |
36982479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 107 - 200
Target Start/End: Complemental strand, 36998050 - 36997957
Alignment:
| Q |
107 |
agcaatcgagactgattccagtgcgaaaactaaggatttgatctcatattggatgcttctttccttaatttacctctttgagtatgcttttatg |
200 |
Q |
| |
|
||||||||||||||||||| ||| |||||| ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36998050 |
agcaatcgagactgattcctatgcagaaactacggatttgatctcatattggatacttctttcattaatttacctctttgagtatgcttttatg |
36997957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 88 - 200
Target Start/End: Complemental strand, 36989077 - 36988965
Alignment:
| Q |
88 |
acaggtgggcttccatacaagcaatcgagactgattccagtgcgaaaactaaggatttgatctcatattggatgcttctttccttaatttacctctttga |
187 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||||| ||| ||| |||| || | |||||||||||||| |||||||| ||||||||||| ||||| |
|
|
| T |
36989077 |
acaggtgtgcttccatacaagctatcgagaccgattctgatgcagaaattaagaatataatctcatattggatacttctttcattaatttacctatttga |
36988978 |
T |
 |
| Q |
188 |
gtatgcttttatg |
200 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36988977 |
gtatgcttttatg |
36988965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University