View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1602_low_63 (Length: 227)
Name: NF1602_low_63
Description: NF1602
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1602_low_63 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 27939302 - 27939518
Alignment:
| Q |
1 |
cattctccatctcatcatcaagaacatcacgattacgctccaccattgttctccttcccctatgtgtgatgttcaactgtgaagaggaaccctcactaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27939302 |
cattctccatctcatcatcaagaacatcgcgattacgctccaccattgttctccttcccctatgtgtgatgttcaactgtgaagaggaaccctcactaat |
27939401 |
T |
 |
| Q |
101 |
gatcccatcaaatgttaagtaaagcatatcgcacgatttagaattgatcgatcgttggtggaccctactatgtgaattataagtaggggacaaaattatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27939402 |
gatcccatcaaatgttaagtaaagcatatcacacgatttagaattgatcgatcgttggtggaccctactatgtgaattataagtaggggacaaaattatt |
27939501 |
T |
 |
| Q |
201 |
tggtgatctaacctatg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
27939502 |
tggtgatctaacctatg |
27939518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University