View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16031_high_3 (Length: 287)
Name: NF16031_high_3
Description: NF16031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16031_high_3 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 252; Significance: 1e-140; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 20 - 287
Target Start/End: Complemental strand, 33519700 - 33519433
Alignment:
| Q |
20 |
atatgagtacctgatcaccaattggaatgccatctctcattcctgttgtttgcaaaaagccttttattggacgagctgcttcgagagggcaagttgagag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33519700 |
atatgagtacctgatcaccaattggaatgccatctctcatcccagttgtttgcaaaaagccttttattggacgagctgcttcgagagggcaagtagagag |
33519601 |
T |
 |
| Q |
120 |
gtagcattccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctaggcaac |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519600 |
gtagcaatccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctaggcaac |
33519501 |
T |
 |
| Q |
220 |
tggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaaccttgc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33519500 |
tggctcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaaccttgc |
33519433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 24 - 285
Target Start/End: Original strand, 33496260 - 33496521
Alignment:
| Q |
24 |
gagtacctgatcaccaattggaatgccatctctcattcctgttgtttgcaaaaagccttttattggacgagctgcttcgagagggcaagttgagaggtag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| || ||||||| |||||||||||||||| ||||| || ||||| ||||||||| |
|
|
| T |
33496260 |
gagtacctgatcaccaattggaatgccatctctcatcccagttgtttccagaaagcctcttattggacgagctgcctcgagtggacaagtagagaggtag |
33496359 |
T |
 |
| Q |
124 |
cattccttggcatagagagccccgtagttattgatgccaatgaagtccaggctgcctcttaggaggctcttctccttagatgagaacctaggcaactggc |
223 |
Q |
| |
|
|| ||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||| | |||| | | |||||| || |
|
|
| T |
33496360 |
caatccttggcatagagagctccatagttattgatgccaatgaagtccaggctgcctcttaggagactcttctccttcgtagagatctttggcaaccggt |
33496459 |
T |
 |
| Q |
224 |
tcccaagaatagagcgcatatcagcagggtactcgccaaaaactaggggatctagtaacctt |
285 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33496460 |
tcccaagaatagagcgcatctcagcagggtactcaccaaaaactaggggatctagtaacctt |
33496521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University