View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16031_low_2 (Length: 393)
Name: NF16031_low_2
Description: NF16031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16031_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 14 - 163
Target Start/End: Original strand, 41636676 - 41636825
Alignment:
| Q |
14 |
aacctgtgatctggaggatcgagcacggggttttgcatgatcatcaagagagagtttcaactccagctagttagaagaattcagcaaaagccgaatagag |
113 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41636676 |
aacctgtgatctggaggatctagcacggggttttgcatgatcatcaagagagagtttcaactccagctagttagaagaattcagcaaaagccgaatagag |
41636775 |
T |
|
| Q |
114 |
agaaattggtgatggtgaatatgaaggagctatgagtgtgatttgagtgg |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41636776 |
agaaattggtgatggtgaatatgaaggagctatgagtgtgatttgagtgg |
41636825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 206 - 378
Target Start/End: Original strand, 41636854 - 41637024
Alignment:
| Q |
206 |
gttgttgttgggtcatctgtgaagtaaaacttctctctttctttctttcgattcggacatcatttacccaaccgacatcccaccttcttacattctcatt |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41636854 |
gttgttgttgggtcatctgtgaagtaaaacttctctctttctttctttcggttcggacatcatttacccaaccgac--cccaccttcttacattctcatt |
41636951 |
T |
|
| Q |
306 |
catttctcatctcaattaagtcatttcatcttaatgtttcaagttcgattgtcaaaataaaaagataaggtta |
378 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
41636952 |
catttctcgtctcaattaagtcattttatcttaatgtttcaagttcgattgtaaaaataaaaagataaggtta |
41637024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University