View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16031_low_4 (Length: 339)
Name: NF16031_low_4
Description: NF16031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16031_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 15 - 324
Target Start/End: Original strand, 41562064 - 41562373
Alignment:
| Q |
15 |
cttctctaacatttatatcgcaccaacgagataaaatttgagatggattttattaattgcatcttatttttatcgatgattcatatgtttctttttaaga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41562064 |
cttctctaacatttatatcgcaccaacgagataaaatttgagatggattttattaattatatcttatttttatcgatgattcatatgtttctttttaaga |
41562163 |
T |
|
| Q |
115 |
gaaattctacttttggcaaaaaggtgtatcgcgacaaatatcaagatgttacaatgttatgttgactaaaccctactccgcatctatattttactcccca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41562164 |
gaaattctacttttggcaaaaaggtgtatcgtgacaaatatcaagatgttacaatattatgttgactaaaccctactccgcatctatattttactcccca |
41562263 |
T |
|
| Q |
215 |
tgaattctagtaaagttgatattcaatggaccaaaataattcgtgatccttttgggacgttcattctcgtgacatataacacctctcttttaataattag |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41562264 |
tgaattctagtaaagttgatattcaatggaccaaaataattcgtgatccttttgggacgttcattctcgtgacatataacacttctcttttaataattag |
41562363 |
T |
|
| Q |
315 |
cctagtatta |
324 |
Q |
| |
|
|||||||||| |
|
|
| T |
41562364 |
cctagtatta |
41562373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University