View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16032_high_11 (Length: 203)
Name: NF16032_high_11
Description: NF16032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16032_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 7750906 - 7751074
Alignment:
| Q |
17 |
gatgaagggatttcaccagacacatggggtaaagcggagaattggagaacttgaagaaatgggagatttcctaccgaggatgggaattcgttgttgatgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7750906 |
gatgaagggatttcaccagacacatggggtaaagcggagaattggagaacttgaagaaatgggagatttcctaccgaggatggaaattcgttgttgatgt |
7751005 |
T |
 |
| Q |
117 |
catccgcattaatgactacaagcgaattgacacggccattcgtgtcacacgtgatgcctgtccagttct |
185 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
7751006 |
catccgcattaatgactataagcgaattgacacgaccattcgtgtcacacgcgatgcctgtccagttct |
7751074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University