View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16032_high_11 (Length: 203)

Name: NF16032_high_11
Description: NF16032
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16032_high_11
NF16032_high_11
[»] chr7 (1 HSPs)
chr7 (17-185)||(7750906-7751074)


Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 17 - 185
Target Start/End: Original strand, 7750906 - 7751074
Alignment:
17 gatgaagggatttcaccagacacatggggtaaagcggagaattggagaacttgaagaaatgggagatttcctaccgaggatgggaattcgttgttgatgt 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
7750906 gatgaagggatttcaccagacacatggggtaaagcggagaattggagaacttgaagaaatgggagatttcctaccgaggatggaaattcgttgttgatgt 7751005  T
117 catccgcattaatgactacaagcgaattgacacggccattcgtgtcacacgtgatgcctgtccagttct 185  Q
    |||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||    
7751006 catccgcattaatgactataagcgaattgacacgaccattcgtgtcacacgcgatgcctgtccagttct 7751074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University