View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16033_high_6 (Length: 356)
Name: NF16033_high_6
Description: NF16033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16033_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 14 - 340
Target Start/End: Original strand, 17106433 - 17106759
Alignment:
| Q |
14 |
tcacttgcttgctcctttttctgccatggctgctgaatttgttggcggtgcaattgttaattcaatcattcaggtcttggttgataagttagcttcaacc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106433 |
tcacttgcttgctcctttttctgccatggctgctgaatttgttggcggtgcaattgttaattcaatcattcaggtcttggttgataagttagcttcaacc |
17106532 |
T |
 |
| Q |
114 |
gaaatgatggattattttcgaactaaactcgatgggaatttgctgatgaaattaaacaatagtttgatttccatcaatgctgttgttgaatatgctgagc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106533 |
gaaatgatggattattttcgaactaaactcgatgggaatttgctgatgaaattaaacaatagtttgatttccatcaatgctgttgttgaatatgctgagc |
17106632 |
T |
 |
| Q |
214 |
agcagcagatcagaagatctactgtgaggacatggatttgtaatgtcaaagatgctataatggatgctgaggatgttcttgatgaaatctacatacagaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17106633 |
agcagcagatcagaagatctactgtgaggacatggatttgtaatgtcaaagatgctataatggatgctgaggatgttcttgatgaaatctacatacagaa |
17106732 |
T |
 |
| Q |
314 |
tttgaagtccaagcttccttttacttc |
340 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
17106733 |
tttgaagtccaagcttccttttacttc |
17106759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University