View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16033_low_16 (Length: 212)
Name: NF16033_low_16
Description: NF16033
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16033_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 24 - 152
Target Start/End: Original strand, 4090024 - 4090152
Alignment:
| Q |
24 |
gcaccaacacttttgattgaaggtatgttccggtgtccaacatgtgtcagtgtctgacacaacaccggcacaagtgattgctttgagttatgtcattttc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4090024 |
gcaccaacacttttgattgaaggtatgttccggtgtccaacatgtgtcagtgtctgacacaacaccggcacaagtgattgctttgagttatgtcattttc |
4090123 |
T |
|
| Q |
124 |
tcaaaattttactggggtcaacatctcaa |
152 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
4090124 |
tcaaaattttaccggggtcaacatctcaa |
4090152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 128
Target Start/End: Complemental strand, 7942374 - 7942269
Alignment:
| Q |
23 |
agcaccaacacttttgattgaaggtatgttccggtgtccaacatgtgtcagtgtctgacacaacaccggcacaagtgattgctttgagttatgtcatttt |
122 |
Q |
| |
|
||||||||||||| |||| ||||| ||| ||||||| ||| ||||||||||| |||||| ||| | |||| |||||| | |||| |||||||||| | |
|
|
| T |
7942374 |
agcaccaacacttctgatctaaggtgtgtcgtggtgtccgacacgtgtcagtgtccgacacagcactgacacatgtgattacattgaattatgtcattgt |
7942275 |
T |
|
| Q |
123 |
ctcaaa |
128 |
Q |
| |
|
|||||| |
|
|
| T |
7942274 |
ctcaaa |
7942269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 56 - 89
Target Start/End: Original strand, 29651731 - 29651764
Alignment:
| Q |
56 |
gtgtccaacatgtgtcagtgtctgacacaacacc |
89 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
29651731 |
gtgtccaacatgtgtcagtgtctgacacgacacc |
29651764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University