View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16034_high_14 (Length: 293)
Name: NF16034_high_14
Description: NF16034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16034_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 18 - 179
Target Start/End: Complemental strand, 32436381 - 32436220
Alignment:
| Q |
18 |
accacacagcaaatctacatgccttttgcttcatgcaaactggctcaccattctagtctcctctgctgcaagcaactacttccccaacacaagtgggcct |
117 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| | | |
|
|
| T |
32436381 |
accacacagcaaacctacatgccttttgcttcatgcaaaccagctcaccattctagtctcctttgctgcaagcaactacttccccaacacaagtgtggcg |
32436282 |
T |
 |
| Q |
118 |
ctgcatactctagccattgcaacaacaacttccctaccacacattttccgagagattatgtg |
179 |
Q |
| |
|
|| || | ||| |||||||||||||| || |||||||||||||||| ||| ||||||||||| |
|
|
| T |
32436281 |
ctacacagtcttgccattgcaacaacgacgtccctaccacacatttgccgggagattatgtg |
32436220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 274
Target Start/End: Complemental strand, 32436221 - 32436160
Alignment:
| Q |
213 |
tgctccctccagcaaatgccatctctaacggacccttcatcagcagccgatcattagcaaga |
274 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
32436221 |
tgctccctccagcgaatgccatctctaacggacccttcatcagcggccgatcataagcaaga |
32436160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University