View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16034_high_26 (Length: 241)
Name: NF16034_high_26
Description: NF16034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16034_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 228
Target Start/End: Complemental strand, 3585293 - 3585090
Alignment:
| Q |
16 |
caaaatgagcttagacaatgatcatcctcaaggttagtagtactatatagtacttattttaattagttttcaatgttttaattttgattggagaaagaaa |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3585293 |
caaaatgagcttaaacaatgatcatcctcaaggttagtagtactatat---------tttaattagttttcaatgttttaattttgattggagaaagaaa |
3585203 |
T |
 |
| Q |
116 |
gaaattagtgttataatgcaatgatgacttaggttgagctgccatgtgctaatgtagagtccaacaagaactgggggaaacttgtttcggccacgttggc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3585202 |
gaaattagtgttataatgcaatgatgacttaggttgagctgccatgtgctaatgtagagtccaacaagaactgggggaaacttgtttcggccacgttggc |
3585103 |
T |
 |
| Q |
216 |
agctgctgttatt |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3585102 |
agctgctgttatt |
3585090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University