View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16034_low_19 (Length: 271)
Name: NF16034_low_19
Description: NF16034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16034_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 86 - 253
Target Start/End: Complemental strand, 35166806 - 35166639
Alignment:
| Q |
86 |
ggggaatgtttggtttgaactagtttgtgtgtttttgagattcctatgatgttttttccccctcttctatatagtgtttctttgcatgttgcatgtgaaa |
185 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35166806 |
ggggaatgtttggtttgaactagtttatgtgtttttgagattcctatgatgttttttccccctcttctatatagtgtttctttgcatgttgcatatgaaa |
35166707 |
T |
|
| Q |
186 |
gaggtgggaagagtatttttatgaatctgagtcatgtaaaggacaaaatggaccgagccaccaatatt |
253 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35166706 |
gaggtaggaagagtatttttatgaatctgagtcatgtaatggacaaaatggaccgagccaccaatatt |
35166639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 35166891 - 35166843
Alignment:
| Q |
1 |
ttgaaacgtttgtgatgttttttggttattttaaggattgccattttac |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35166891 |
ttgaaacgtttgtgatgttttttggttattttaaggattgccattttac |
35166843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 153 - 248
Target Start/End: Complemental strand, 14537723 - 14537628
Alignment:
| Q |
153 |
tatatagtgtttctttgcatgttgcatgtgaaagaggtgggaagagtatttttatgaatctgagtcatgtaaaggacaaaatggaccgagccacca |
248 |
Q |
| |
|
||||||| ||||||||||||||| || ||||| |||| |||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14537723 |
tatatagagtttctttgcatgttctatctgaaaaaggtaggaaaagtatttttatgaatctgcatcatgtaaaggacaaaatggaccgagccacca |
14537628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University