View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16035_high_2 (Length: 254)
Name: NF16035_high_2
Description: NF16035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16035_high_2 |
 |  |
|
| [»] scaffold0530 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0530 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: scaffold0530
Description:
Target: scaffold0530; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 18 - 254
Target Start/End: Original strand, 4416 - 4652
Alignment:
| Q |
18 |
agaatgaccattgtataatgttaccaaacatggtgcttcatgctgcttgcatttttgtgtttggaatgtacaaacaggtgagtaagcaatcaaccatatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4416 |
agaatgaccattgtataatgttaccaaacatggtgcttcatgttgcttgcatttttgtgtttggaatgtacaaacaggtgagtaagcaatcaaccatatc |
4515 |
T |
 |
| Q |
118 |
cgtctcttatatctaatcagaataagtagtctgagctggatgttggggaacaactgaggttgaaggcggcggcggcaatatattcggttcatcaaatgga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4516 |
cgtctcttatatctaatcagaataagtagtctgagctggatgttggggaacaactgaggttgaaggcggcggcggcaatatattcggttcatcgaatgga |
4615 |
T |
 |
| Q |
218 |
ttggttgattttttaatcattgtgaatggttcctcct |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4616 |
ttggttgattttttaatcattgtgaatggttcctcct |
4652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University