View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16037_high_4 (Length: 218)
Name: NF16037_high_4
Description: NF16037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16037_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 52512383 - 52512171
Alignment:
| Q |
1 |
ttcgaggcgtcaatgtcttaaatgtttgtgttcaactccatttttaattaatgcaaccaactcagcagcaaccgctcttgataagcctcctggttgcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512383 |
ttcgaggcgtcaatgtcttaaatgtttgtgttcaactccatttttaattaatgcaaccaactcagcagcaaccgctcttgataagcctcctggttgcaga |
52512284 |
T |
|
| Q |
101 |
aattgtggtggaagtggtaacatcatttgtgagtcctcttctcttttctcttcattcctttt-----------taataataatattcttcttccttatta |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||| | ||||||||||||| |
|
|
| T |
52512283 |
aattgtggtggaagtggtaacatcatttgtgagtcctcttctcttttctcttcattctttgttataataataataataataataatattcttccttatta |
52512184 |
T |
|
| Q |
190 |
taatactactttt |
202 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52512183 |
taatactactttt |
52512171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University