View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16037_low_4 (Length: 230)
Name: NF16037_low_4
Description: NF16037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16037_low_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 30 - 230
Target Start/End: Complemental strand, 52512657 - 52512457
Alignment:
| Q |
30 |
ctctattcttcatatctcaatggattgcaatttgcaggcgtctgttattcctcgatgccttcctccaacttccatcaaacaaacaggaaggacgcgttgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512657 |
ctctattcttcatatctcaatggattgcaatttgcaggcgtctgttattcctcgatgccttcctccaacttccatcaaacaaacaggaaggacgcgttgt |
52512558 |
T |
 |
| Q |
130 |
tttattgttaaatccactcctcctcaaaatcaaggatatcattcttcctccaaggtatgtatgtatgtttatatacgagtttcaattcaatttcaattac |
229 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52512557 |
tttattgttaaatccactcttcctcaaaatcaaggatatcattcttcctccaaggtatgtatgtatgtttatatatgagtttcaattcaatttcaattac |
52512458 |
T |
 |
| Q |
230 |
t |
230 |
Q |
| |
|
| |
|
|
| T |
52512457 |
t |
52512457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University