View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16037_low_5 (Length: 220)
Name: NF16037_low_5
Description: NF16037
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16037_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 193
Target Start/End: Original strand, 43017381 - 43017573
Alignment:
| Q |
1 |
aaattcattgatttatactaggagtaggaaaggttttatatatgtatgtggttgccaaataacaagcatgaaactgtctaatcactttttgattgtcaat |
100 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43017381 |
aaattcattgatctatactaggagtgggaaaggttttataaatgtatgtggttgccaaataacaagcatgaaactgtctaatcactttttgattgtcaat |
43017480 |
T |
|
| Q |
101 |
tgtcatctatggatcaaacacaatgattacttagaatttgattgatatgttgaaaattgatgtataatatgtatccacatggcagcaacagca |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43017481 |
tgtcatctatggatcaaacacaatgattacttagaatttgattgatatgttgaaaattgatgtataatatgtatccacatggcagcagcagca |
43017573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University