View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16038_low_12 (Length: 210)

Name: NF16038_low_12
Description: NF16038
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16038_low_12
NF16038_low_12
[»] chr2 (2 HSPs)
chr2 (88-197)||(14780981-14781090)
chr2 (16-85)||(14780632-14780701)


Alignment Details
Target: chr2 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 88 - 197
Target Start/End: Original strand, 14780981 - 14781090
Alignment:
88 tatattacagcacatctcatacgtgactcaatttaataagctcccagcaaactttaggagcagatttcttgtgataaaaaaggtataccaaacttaatta 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
14780981 tatattacagcacatctcatacgtgactcaatttaataagctcccagcaaactttaagagcagatttcttgtgataaaaaaggtataccaaacttaatta 14781080  T
188 agatcaactt 197  Q
    ||||||||||    
14781081 agatcaactt 14781090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 16 - 85
Target Start/End: Original strand, 14780632 - 14780701
Alignment:
16 atatatatagtactaggcactagaaataatctctggtgtagaattcactatcggaagcacctaattacta 85  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
14780632 atatatatagtactaggcactagaaataatctctggtgtagaattcactatcgaaagcacctaattacta 14780701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University